Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig88
Contig Information
Length 477 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14c07    rwhec14c07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group] >gi|125539377|gb|EAY85772.1| hypothetical protein OsI_07133 [Oryza sativa Indica Group] >gi|125582027|gb|EAZ22958.1| hypothetical protein OsJ_006441 [Oryza sativa (japonica cultivar-group)]
Score 130
Evalue 2.50701e-06
Total Hit Count 31
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig88
CTCTCACCTTGCGACTGCGGCCAGCACACTATCCACCTCCACGTCCACAGCCAACGCCCGATCTCCCATCCTATGGAGCAGCGTCACGCGGACAAAATGC
CGGCGAGCGCGCAGCATCACGACGAGCACCCGAAGCAGCAGTCTCCCGACGAGGAGGAGGCTTCTTCGCTGAGCCCCACGGTGGCGAGGCTGGTCCGGGA
GTCCATCGTCTCCAAGCCGGCGGACGGCGGGAAGGCGGCCGGCGGCGGCTCGTCGGACATCCTGGCCTTCGCGCGCTCCGTCGACCGGGTGGACTCCAGC
CTCGAGTAGCTTCGCTAGTTTGTGCTTAGGTGACCCACGCTCGCTTGCTTGTACCGTAGTAATAAAACGCTCTACAGTTTATTTCCCTTATTGTAAGTTG
CAGAACACCTCATTCGCATCCTTGTCTTTTCCCTCTTTTTTCAAACTGAGAAGCAAGGTTGCTAATTAAAAAAAAAA
page-top