Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig87
Contig Information
Length 604 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15j16    rwhec15j16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit delayed flowering1 [Zea mays]
Score 140
Evalue 3.18642e-07
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig87
CCCAGATCGAGTCGGAGGTGCACCAGCTGCGCGAGGAGAACGAGCAGCTCCGCCTCAAGTACGACCAGCTCAAGGCTTCAGTGGAGGTGTCGGTGCCGGT
GAGGAAGACCCTGCAGAGGGTGCTCTCGGCGCCCTTCTGATCTTTCCTCCACGAGGGATCGAGATCGAGGCTGCAGCTCCTACAACCACCGCCAGTACTA
CTCACATAGCTAGAGTGTTGCAGTAGCTAGCTCTTACTAGTAACTATTAGCTGCTGCTGCTGCTGCTGCTACTACGATGCTCATCCATCATCGTCCCTGT
AAATCCATATGGATGGTATTATGTTCTCCTTTTCCTTGACTTTCACTAGGCCGGCCGGGGCTATCTCGATCTTTTTTGGTCACTCAGCTAAACCAGAGGT
GGCAATGCGCAAGGAAAGGGAAGAAGACGCAGCAGCTTAATCTGTACAGCGGCAGCTGCTGCCTACCTACCAGTAGTAGATCTCCTAGCAATTACAGCCG
TTGTGGATTAGCCAGGCAGCAGCTGGTTCTTGTTTTGCTGACTTGGCGATTAATGATATTATGGTGCTACTCCTACTTATCAGTTCTAGTAGTACTGGTA
ATAA
page-top