Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig86
Contig Information
Length 633 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14g03    rwhec14g03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Em protein [Triticum aestivum] >gi|7594652|emb|CAB88089.1| Early-methionine-labelled polypeptide [Secale cereale]
Score 377
Evalue 1.17685e-34
Total Hit Count 85
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig86
TAGAGCACACACGCTCCCTTCCAGTTGAGGTCGAAGTAGCTAGCGAGGAGTGAGCGATGGCCTCCGGTCAGCAGGAGAGGTCGCAGCTGGACCGCAAGGC
CCGTGAGGGCGAGACCGTCGTCCCCGGCGGTACCGGCGGCACCAACCTCCAGGCGCAGGAGAACCTCGCCGAAGGGCGCAGCCGCGGCGGGCAGACGCGC
AAGGAGCAGATGGGGGAGGAGGGGTACCGCGAGATGGGGCGCAAGGGCGGGCTGAGCACCAACGACGAGTCCGGCGGCGAGCGCGCGGCCAGGGAGGGCA
TCGACATCGACGAGTCCAAGTTCAAGACCAAGTCCTAGATGATCCGTTAGCCTAGCAAGCAAGACGACTGCTTAGTTGGTTGGTTTACCTTGCAGGATGA
ATAATGTAGGTCAGGGATCCTGACGTGTGCACGCATGTAGGAGATCATATGTACTAGATCATGTGTGCTTGGTGGTTAATAGTAGCCGGTAGTCCGTACT
AGGTACTGATGGTCAGTCAGAGTCGTGTGTCCGTGTCAGTCGGAAGTGTGGTTGTGGCTCCGGCGGCTGGTCCGGCCTCTCTTCCCACACCAGCTTTCCG
CTGTATCCTTGTGTTTCCAGTAATGCAAGTCGT
page-top