Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig85
Contig Information
Length 797 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15b07    rwhec15b07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group] >gi|218188387|gb|EEC70814.1| hypothetical protein OsI_02278 [Oryza sativa Indica Group]
Score 130
Evalue 8.34217e-06
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig85
TGCACCTGAACCACTAGCCTACCTAGCTAGCTACATCGGCAAGTCGGCAGAGCTCGTGATCAATGGGGGTCAAGCTCACGCTCCCGCCGGCGGCACTGAT
CTCCCAGGTGGCCAAGCTGAGCTCCCTCCTCGCCCTCCTCCTCCTCGCGCTGCTGCTGCCCGTCTTCCTCAGGGTCGCCTACGGCTACCTCCTCTTCAAC
GGCATCGTCCTCGCGCTCGGCATCCAGGCCTTCGTTGGCGGCGGCGGCGCTTCCATCGCCGACGACGAAGACCGGCACGGGTCTCCGAGTGCCGGTCAGG
CCGTCGAGGCCTCGCCGTTCCAGAGGGCTGGAGCTGAATCAGTCCGTCCCGACGAACGGGCGGCGGTTCTGGGTGATCTTGTCGTGGTGCCTGCCTTTGT
GGCGAGTAATATATTCGAGCTGAAGACCAAGACCAAGGAGGTGGTGCTGAAGGTGCTGAAAAAGTGCCCGTCGACGGCGAGCATCTTCTTCCTCAGCTCG
CTGAACGGCGGCCAGCAAGCCGGCGAAGAGGAAAAGGCACGCCAGGAGGAGGAGGAGGAGGAGGAGGAAGATTGTGAAGTCGACATGGACGGGGACGTGA
AGATGAGTCGGGAGGAGCTGTTTGCCAACACGGAGAGGTTCATCGGCAACTTCCGCAGGGAGCTCAGCATGCAGAGACAGTAGCACTACTCCAAGCTAGC
ATAGATATTTTGGCTTAGCTTTTTCTTATTATTTTTCTTTAGTTTGTTGCGTCATGTTATATAGGAGTATGTGTAGGGTGACACGTCCTTAGTCCAC
page-top