Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig84
Contig Information
Length 578 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15j10    rwhec15j10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GAD1 [Hordeum vulgare]
Score 570
Evalue 3.97683e-57
Total Hit Count 371
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig84
GGGCGGTTCGACGTGCTCTCCAAGGCGGACGGCGTGCCGCTGGTGGCCATCAGGCTCAAGGACAGCACCAACTTCAGCGTGTTTGACATCTCGGAGAACC
TGAGGAGGTTCGGGTGGATCGTGCCGGCCTACACCATGCCCGCGGACGCGGAGCACGTCGCGGTCCTCCGCATCGTCATCCGGGAGGACTTCAACCGGAG
CCTCGCGCAGCGGCTCCTCGCCGACATCAACAAGATCGTGCGCGAGCTGGACGCGCACGCCGTCCACGCCATCAAGCTGTCCAACGCCGCCGCCGCCGAG
GGCGCCTCCAAGAGCACCGTGGACGCCGTCACCGAGGCCTTCAAGGGCCTGGCCGGGAACAAGAAGGCCGGAGTCTGCTGATGGCCGTGCTTTGTTTTAA
CACGTCTGTCTATGTTGTATCTTGATTCTTGTATAATTATTGTGGAGGGGTGCGTATGTGAACTGTCAAGACCTGCCTCCTCCGTATTTTGTACGTACGC
ACGCGGATTGCACTGTCACTTGTATAATTCTATCTGTTTCTTTTTAATAAAGGGGTTTTCCCCNGCTCCANTTTTAAA
page-top