Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig83
Contig Information
Length 800 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15j08    rwhec15j08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Laccaria bicolor S238N-H82] >gi|164635303|gb|EDQ99612.1| predicted protein [Laccaria bicolor S238N-H82]
Score 82
Evalue 3.0935
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig83
CTCCTCGGCCCTGTCCTCCGCCTCCACCTCCCCGCCTCCAAGCGATGACGACGGCCCGAGATCCATGGTGACGGCGGCTGCAGTGGCCCGATGGAAGCGG
CGGCCATCCCTAGCCGTTGCCGCGTGCTTCTGCTACTCACGTTGGCCATGGATCTGCAGCAGGGGCCTCCCTCCTCCGTTTCCCAGAGCCCGCAGCTAAT
TCGCCATCCGGAGATTCGGAGCAGCAAGCGCCGGACGAGGACCGTAACCTGCTGGAGGCCCGAGCGCGACCTCGTCAACGGCGACGACGCCCCGCACAAG
ATCAGTAGGAGCTCTCTGCCTCTCCAATTCCATGGACGGCGACGACCGGGACCCCACGCTCAAACCCGACGAGCTTGAACGGCGAGGTCATCCGAGCCGA
CCATCATGATTCCCCACAGAACAATAAGATTGGAGCCTAAGGTTGGACATTTTGATGGGACTGCGGATCTTCGGATGTTGGTGCTGAGATTGATGTGGCC
CTAGCTACATGTAAGCGAAGCTTATGATGTCGATCCTCCAGGCTGCACTGCCATCGTTTTACCTCAGAAACTGTTGGTATGATTGCGTACCGGGCTACTT
GGTGCTGCCCATCACAATTTGCACTGACATGGTAACTTCCATCAAGAGGGCCGACTGCAAGAACTTGAATAGCAACTTCAATAGTTTAAATGTTCTGTTT
GTGTGAACTGGATTGTACTGTTTTTTAACTTTCCCAAGTAATATATGTTGTAAACTATCATTTCATGGAGGATTTTGTAAGCTGCTATGTTGTAGATACT
page-top