Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig82
Contig Information
Length 288 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15j04    rwhec15j04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0514400 [Oryza sativa (japonica cultivar-group)] >gi|50725355|dbj|BAD34427.1| putative protein farnesyltransferase/geranylgeranyltransferase type I alpha subunit [Oryza sativa Japonica Group] >gi|113631892|dbj|BAF25573.1| Os09g0514400 [Oryza sativa (japonica cultivar-group)] >gi|125564361|gb|EAZ09741.1| hypothetical protein OsI_32029 [Oryza sativa Indica Group] >gi|215686338|dbj|BAG87599.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704338|dbj|BAG93772.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737591|dbj|BAG96721.1| unnamed protein product [Oryza sativa Japonica Group]
Score 161
Evalue 6.52882e-10
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig82
CTCTGATCCTGAAACGGGACATGCTGATATTGCAGTAGCTGTCTGCTCAATCCTGCAGAAATGTGATCCCCTGCGGATAAACTACTGGTCATGGTACCAG
ACCACTCTTTCTTCTTAGACATCTGAAAATTCAGCTGAAGATAGTTTTAGCAGCATGATGTAAACTCAATCGAAGGGGTTGACGCACTGTATGAAAAACC
TTTCCTGTGATCTTGGCGCGGAGCAAAATTTGTATTGATTTTACTGGGAAAAAATCAATCAATGACAGCATGCCCAACAAAAAAAAAA
page-top