Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig81
Contig Information
Length 493 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14c24    rwhec14c24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Nematostella vectensis] >gi|156211191|gb|EDO32313.1| predicted protein [Nematostella vectensis]
Score 87
Evalue 0.252169
Total Hit Count 37
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig81
GTATTGATGAGGTGGTCTTCGCGAAAAAGCTTGGCCGCTTGCTCACCAGCTTGGATGCAGCTTGTCCTGGGTCTGCCAAGACGATTGCTTGCCTCCTAGC
GGAGGAGGTTTCTACGGGCAAAATAAAGAAGGTGAAGAAGGCTATCAGGAACATAGGCAAGAAGACTGACGTTATTAGGAAGGCGTCCGCGACTGCTTAA
TGGAGGATGCTCAGTCTTTTTGTCATCCATCTTCGATTGACTCGCCTCTGTGGATTTGGTGGCGTTCGGTGGTTTCGTTGAGGGTTTCGTTGCGATGTCA
TTTTGCGAGGGCTTATGGTTGTTGCATGTTATGTATGTTTGTTGGGTTGACCATGGTGTCATGGAGTTTCTTTCTTAGAGAGTAGTCCGCATGTGGTCTA
TATGTATCGGTTTTCGCCCGGTTTTCCTTTAATTAACTGGGCAATTCTCTTCTTCTTAATTAATCNATGAGGCAAATCTTTTGCCTCCGTTTC
page-top