Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig80
Contig Information
Length 1021 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14d06    whec19f13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_022863 [Oryza sativa (japonica cultivar-group)]
Score 129
Evalue 1.6556e-05
Total Hit Count 28
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig80
GTACGTGAGCCTTCCCAGTGCAAGTGTGTGTGCATTAATCCTGAGAGAGCTAGTTACTTTTAGTTATCTAACACTCCGTCGGTGGCAACGGCAGCTCCTT
CTTACCGGATCAAGGCGCGGAGGTCCATGCTCCCCTCATCTGGTCAGACACAACAGAGCACAATTCTTCCTTGCCATTCTGCTACATGTACGAACTGAAG
CTGGTTGTGTACACTCAGGTTGCTTTTTTAGAGAGAAAACACTCTGGTTGCAGGTAGAATCAGAAATCAAAGTCCACAGAGATGCATATGTCATGGGCGA
ATGCATGATGTGATAGAATTCAGAGGACCTTCAGACTTGGTTCTCTGCTGGGTGTGAAGTGTTTTGCCGAGATGCAGATTCAGAGGATTTTTTCTTTCAA
ATTTCTGGCGCTGGTTCAGGCTGATGTGTGATTCGCCAAACGAAGGAGCAGACATCCATTGAGAAGAAATTCATCCAAGCTCTCAAGTTGAAGTCAAACT
GGCCAGCTACATTTCAAAGTTTTAACCAGGTGCAGAATTTCGTTTGGTATCAATATATCTATTGGGAGATAGAAAGAATATGAGGATCATCATGTTTCCA
GTATGAGACGTGGCTCAGCGATAATTGCATCACCAACGCCAAGCCCACCGAATTCACTAAAAGCAATAAGCAGGAGATCACCACGATGCATATCGCCGTC
ACATTCAAACCCAAATATCTGGGAGCTACGGTCTGGACATGATTAACAGGGCAGGGCAAAGTCAAGCCCCAGTGTGGTGGCGGCAGCAATGGTGGCCTGC
AGGCTACCGGGCTAGCAGCATGGCATGCAGTAGTGTGCAGCGTTTCACGGTGGTGCGCTTGTGGCGGCTGTGGATGATGAAGTACTGGACCTGCGGCTGC
GGTGGACGACCATCCGCAAGATCTACATCATCATCTTTGGGTCAGTTCACCATAATAGCCATTCTGCGATACGAGGTTGTTCCAATTCAGGGTGTGCGTT
CGGTTTTTTCGGTTTGATTCG
page-top