Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig79
Contig Information
Length 650 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14d08    whec19i21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ankyrin repeat domain-containing protein 2 [Zea mays]
Score 827
Evalue 8.34207e-87
Total Hit Count 221
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig79
AGCCTCCTCCGCGTTCGCCGCCGCCCGCCCGCCCGGCCGTCGGATCCGCCATGGCTTCCGACCAGAACAAAGATTCAAAATCGGAGGGGCTGTCTGAGGC
AAAAAAGGGGGCTTCCCCAACAGGTGGTGCAGGCCTGCCCAGTCCTTTTGATTTCTCCAACATGAGCAGCTTGCTCAATGATCCATCTATAAGGGAGATG
GCTGAGCAAATCGCCAGCGACCCTGTATTCAACCAGATGGCTGAGCAGCTTCAGAAAAGTGCGCAGGGTGCAGGGGAACAGGGTGTTCCAAATTTGGATC
CTCAAGCATACATGGAAACCATGACACAAGTTATGCAGAATCCTCAGTTTATGTCAATGGCGGAGCGTCTTGGGAATACTCTTATGCAGGATCCTGCAAT
GTCCAGTATGCTTGAGAACTTGACTAGTCCAGCTCACAAAGAGCAGCTTGAAGAGCGAATGGCCCGTATCAAGGATGATCCGTCTTTGAAGCCAATTCTT
GATGAGATAGAACGTGGTGGTCCATCTGCAATGGTGAAGTACTGGAATGACCCTGAGATTCTTCAAAAGATTGGCCAGGCCATGTCATTGAACTTCCCAG
TAGATGCTGCTACTTCCACTGTANTATCTGGACCTCAAGAAACTGATGAA
page-top