Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig77
Contig Information
Length 332 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15i13    rwhec15i13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein S25-1 [Zea mays] >gi|195658723|gb|ACG48829.1| 40S ribosomal protein S25-1 [Zea mays]
Score 169
Evalue 7.56334e-11
Total Hit Count 204
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig77
TTATATACCTGCAGATCAATGGGTCTCTGGCTCGCAGGGCTATCAAGGACCTGATGGAGAGGGGACTCATCAGGATGGTGTCAATCCACTCAAGCCAGCA
GATCTTCACCAGGGTGACAAACACCTGATTTATCATTATCATGTGTTCCATGTCTGTTTTTAGTCCAGTAGACTGAGGTGTTGCTGTTATATTCAAGTTC
ACTATGTCCAGGGGGGCACACTGTGCCACCAGTAATGTTGAATTGCTTTTGAGTTTTGGTACACTTTAAGATCGTTTTGTCAGCGCAATGAAATCTACCT
TATATATTGCTCTATTTGCTGCAAAAAAAAAA
page-top