Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig74
Contig Information
Length 708 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14d18    rwhec14d18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L12 [Pyrenophora tritici-repentis Pt-1C-BFP] >gi|187983696|gb|EDU49184.1| 60S ribosomal protein L12 [Pyrenophora tritici-repentis Pt-1C-BFP]
Score 716
Evalue 7.34377e-74
Total Hit Count 405
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig74
TACGGCAGTCACTCTTTACACCAGAAGCAATTGACTACCTCAAGCACTAGCCATGCCTCCCAAGTTCGATCCCTCCGAGGTGAAGGTCATTCACCTCCGT
GCGACCGGTGGTGAAGTCGGTGCCTCATCCGCCCTCGCCCCCAAGATCGGTCCTCTCGGTCTTTCCCCCAAGAAGGTCGGTGAAGATATCGCCAAGGCCA
CTGGTGACTGGAAGGGTCTCCGTGTCACTGTCAAGTTGACCATCCAAAACCGTCAAGCCGCCGTCTCCGTCGTTCCCTCCGCTTCCTCCCTCGTCATCAA
GGCCCTTAAGGAGCCTCCCCGAGACCGCAAGAAGGAGAAGAACATCAAGCACACCAAGTCTGTTCCTCTCGATGAGATCATCAGCATTGCCCGCACCATG
CGCTTCAAGTCCATGGCCAAGGACCTGAAGGGTACCGTTCTTGAGATCCTCGGAACTGCCTTCTCCACTGGCTGCAAGGTCGATGGCCGCAGCCCCAAGG
ACATCTCCGACGACATCAAGGCCGGCGAGATTGAGATTCCTGAGGAGTAAGCGTTAGCACTAAGAAGTGTTCAACGATCACGATGGAACGATACATGCCA
TAGAGGGTGCTACATAGCTGAATGAGGATCATGTCTCCCACCAGAGTTAGCCATCTCGAGACCGGTGGAGTTTGCACAGCTGCGGCGTTTGGGATTTTTG
ATACCATA
page-top