Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig73
Contig Information
Length 988 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14d19    rwhec14d19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit proteasome maturation factor-like protein [Oryza sativa Japonica Group] >gi|51091632|dbj|BAD36401.1| proteasome maturation factor-like protein [Oryza sativa Japonica Group]
Score 291
Evalue 2.57057e-24
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig73
GCTCGGCGAGACCCACGACGTCCTCCGCTTTGGCGCCAACGACAGCGTCCGCGGCGACCTCGCGCCGGCGCACCCCGTCCAGGCCACCATCCACAAGGAG
GCCAAGTTCTGGGACGAGAAGAAGAAGTTTGGGACCGAGGCCATCTACGGATCGGCCTTCAACATCCGCAGGGATCTCGACGCCCAGATCCTCTCCAGTG
TTTGCACTGTGGTGGGTGGTGGTCGATTCGCAGCACCGGAGCAGTTGTGCAGGGTCGCGGGTGGTCGTCGATTCGCAGCACCAGAGCAGTTGTGCAGCGT
CGCGGGCGGTCGTCGTGCAGCGTTGCTGGTGGTTCTCGGTGTCAGGCTACGTTGACTGTTGACTTGCTTGTTGATGTGGTCTGCATCTCCTCCCACCACG
ATGGTCGGCAACCAGGCCTTCGCTGCTGGAGCTCTTCAGTATCGCCCCCTCTACATAAATTTGCAGGAAGCCATGAAGTTTACAGGCACTACTCCCAGCA
GGGTTAAGAAAATCCATTTTCAATGGAGTCAATATTCTTTAGAATTTCATTTTGATGACTGTCAGGGTCAGGCGCACCAAAGGATGGACTGTGGTTCCAT
GTCCAAAGGGACAATACTGGACCGGCAGATGAGCGGGCTCTTGCTGATGCAACTCCTTCTGCTGCTCATCAACCTGTCGTTTCATTCTCTCCTCCTCGGC
TAGTCCGTCAAAGGCCACCAGATGATTTCCGAACAAGAAGTTTCCTGCAAAGAGATGGGAGAGGGCAGCGACACCCAGTGAACATAATTTTGTTGATCCT
CCAGCAAGTGTGACCAAGAATGTTGGATCAAAGCTTTGTTCTGGAAGTTCTAATCGATAGTTTCTGTATTGCATACAAAGGGTAATCAATGCTGGGCTAA
AGATCTCTGCTACATGTTCCATGGGTTGAGTATAACCAATCATGTTGCTTATTTTTAGGAGAAGTTCAGACCTGTGAGAAACCAGATG
page-top