Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig64
Contig Information
Length 776 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15h09    whec15h10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27378 [Oryza sativa Indica Group]
Score 167
Evalue 4.04951e-10
Total Hit Count 104
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig64
ATTGGAGCTCATCTTAGCAACATCAGCTTTCGCACAAATGTTGCCATCCAGCATGTCAAAAAAGGTTTTTGATTTACATACAAGAGCAAAAGCCGTTTGA
ACATTTCTGGACGGAACTTGGGGGTGCCTGGAGACAAAGTGCACTATTTTCTCATCTGCGTCAAAAAATCCGCCGGGGGTCTTCCAGGCCCTGCAGCGCC
ACTCCCACCAAATGATGAGAAACCAGTAGCCCCTTGGTTATTACTGCCAAAAGCTCCAAAACCACCACCTCCGAAGCCACCACCCTGGGCTGCACCTCCA
AAACCACCACCCTGGGCCACACCTCCAAAACCACCACCCTGGGCTGCCCCCCCAAAACCACCAGCAGATGAAGCTGCAGCAGCAAAACCACCACCGCTTT
TGGAGGCAAGAGAAGCAAACCCTCCACCGGTAGCAGCAGCAGTAAACCCTCCACCAACAGAAGTAGCAGCTGCAGAGAAACCCCCACCTGCTGCAGCACC
AGCAAATCCAGAATTACTGGAAGGTGCAGAAGCAAAAGCCCCAGAAGAGGAACTAGCAAATCCACCAAAGCCTCCTAGCTGGCGTGATTGTCCGAAAGAA
CCCAGAACAGATCCAAGCGCCTGCTGAGCACCAAGCTGTGCAGGCTGCCCGAATCCTGACTGCTGCCCACCCCCGATTTGTGCAGGCTGCCCAAATCCTG
ACTGTTGCGCAGCTCCAATTTGTGCCGGCTGGCCAAATCCTAACTGAATTTGTGCTGGCTGCCCAAAACCTGCCTG
page-top