Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig63
Contig Information
Length 953 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15h05    rwhec15h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group] >gi|125526771|gb|EAY74885.1| hypothetical protein OsI_02774 [Oryza sativa Indica Group] >gi|125571113|gb|EAZ12628.1| hypothetical protein OsJ_002453 [Oryza sativa (japonica cultivar-group)]
Score 572
Evalue 6.28764e-57
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig63
ACCGGCGGGGGCGTGCAGCCGGCGGGACACATCTTGCTCCTCGTGATCGTGATATCGCGGCGAGCGTCTTGCCCAAGGAAGGGGATCGCGGCGACTCCGC
GACCTCGGACCTCGTATCTTCGCAGCGGCTGGCAGCCAGCACCAGGTCCTCCGGTCTCCGGCAGCAACCAACCTGTGTGGTGCCGGCTCTCAAGTGAGAG
CATCAAGCGAGCACTCCAGCATCCTCCTATTCAAGCTCGAGTGGCACGACCTGATCACCTGTCTAGCTGCTGTGAAATGGACATTTTGTATCAGTGCAAG
GAGATCTTAAAGATTCAGAAGTTTAGGCGATTGGCGTCTTATGCTGGATTCTATTCCTTCACTACCCTCGTTACCTATGCTTACACAAGCAATACGACAA
GAGCTGGCATTTCGAGGGCCGATCAGTATTATGCTTCCTACCCTTCTGGCACTGAGCTATTAACTGACACTGCAAAGCTTTACAAGGCTGCATTAGGTAA
TTGTTTTGAAATAGACGACTGGGGTCCAATAGAATTCTCCATCATGGCAAAGCACTTTGACCGGCAAGGCAAACCACCATATGCTTACCATGCTGTAAGT
GTCTTAATATTTTCAAATAAGCTTCTTTGTTTGGATTAATTTCCACCGCATGGTTTGCAAGTTTAATATCGGCTTTGTACTTTGTTGTTGCAATACATGT
CGCACCTTCTATCCCATGGCCAACTCGATGGAAGTGGTTAACTGTCAGATGTGTTTTAGTTGACTCTCGTGAGGCCTTGGTCTGCCAATTATAAGCACTG
TATCAGGTCTTGTAAAAAAAGAGATGTTTTGATTGGAATCCTGGATTTTGATGGGCCGTGGTCACGGATGAGCCACTTCAGTATCAGCTTATTATCAGTA
TAATGATGGTACCTTATTGAAGCATGGATGTAGTCATTTTTGTTGCTGAATGC
page-top