Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig61
Contig Information
Length 817 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14f01    rwhec14f01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CCAAT-box transcription factor complex WHAP4 [Triticum aestivum]
Score 1150
Evalue 4.56558e-124
Total Hit Count 323
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig61
TTGCGGAGGAGGCAGCGGCAAGGGAGGAGGGGTCGCCGGAAGGGGGACATGCTCCCTCCACATCTCACATCTCGCAGCTTGAACTGAGAGCAAGAGTAGA
AACCCATAAGATGAGACGCAAGCAAAATATGCATGAAAATGGCACAATCATGATTCAGTTTGGTCAGCAAGTGCCTAACTGCGAGTCCTCAGCTAGCGAT
TCTCCTCAAGAAGTGTCCGGGATGAGTGAAGGAAGCTTTAATGAGCAGAATGATCAATCTGGTAATCGCGATGGCTACACCAAGAGTGATGAAGGCAAGA
TGATGTCGGCTTTGTCTCTGGGCAATTCAGAAACAGCATACACACCCCCAAAACCTGACCGCACTCATCCCTTCGCCATATCATACCCATATGCTGATCC
TTACTATGGTGGTGCAGTGGCAGCCTATGGCACACATGCTATTATGCACCCCCAGATGGTGGGTATGGTACCATCCTCTCGAGTGCCACTGCCAATTGAA
CCGGCTGCCGTCGAAGAGCCCATTTATGTGAACGCGAAGCAATACCATGCCATTCTCCGAAGGAGACAGCTCCGCGCAAAATTAGAGGCTGAAAATAAGC
TGGTCAAAAGCCGTAAGCCGTACCTCCACGAGTCCCGGCACCAGCACGCGATGAAGCGGGCTCGGGGGACAGGCGGGCGGTTCCTCAACGCAAAAGAGAA
GTCCGAGGCGGCCTCCGGCGGCGGCAATGCATCAGCAAGATTTGGCCACGCCGGCGTTCCTACAGACGGTGGTGGCATGTTNTTGAAGCACGACCACACC
TTACCGTCCGGTGACTT
page-top