Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig60
Contig Information
Length 970 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14f04    rwhec14f04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195613262|gb|ACG28461.1| hypothetical protein [Zea mays]
Score 290
Evalue 3.23613e-24
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig60
AGCAGCAGCTATTGGAGCTCAGCCATCCAGAAGTGCCAGAGCGCTAGCTTTGGTAGCTGTTCGTCGATAAGAGCCCCCTCCTGCTTCCCACACGCCACAT
ATAGCAATCTTTGCTGCTGCCTCCCGATCCGCTGTACTTCCGGCATCGCAAGCCAAAGATTATCACCGATCCGTCGTTTCTTTCCCTCTAGCGCCAGAAG
AACTTCATCTTCTTCTTTTTTTGCTGAGATTGGTGGTGCTGCTTGGAGTAGACGCCAGCTCTGTGGCAGATTTGTAGCATAGCTTTAGCTGGATTATCTT
AGCACAAGGTGTCTCTGTAAAACACTCAAGTTTCAGTAAGCAAACTGATAAACAGAAGCAGCCGCTTCAGTGGCTGCCCAAACCAATATATAGTTCTTGC
TGCTGCTGCTGCTGCTGCTGCTGCTGAGCTGAACCAACCAATGGGTAGAGGAAGAGGCAGAGGCAGAGGAAGGACGGCGGCCATTGCCAGGAGCCATGAA
GACAAAGGAAGCAGCGGTGAAGAGGTTGTGCCCGCGAGAAAGAGGAGGGGAAGGCCGCAGAAGCACTTCGCCGATAAAATCGAACAGGTTGATGTTGAGA
ATTTCGTAGAAGACGTCGATGGCGGCGATGAAGATGGCAAAGATGTTAAACTGAATGCAAGTGCTGGTGTGAAGAGAGGCAGGCCACTGAAGGAGAGCCC
CAACATCGTCCTGGAAGAGAACAGCAATTCCAGCGTTCGATCAAGCAGCGACGAGTCAGCTAGGACCAATGGGTTCAGGCAGATTGGGAACCGGAGGAAG
AGCACGCCCCGGCGAGCAGCGGAGGCAGGGCTAGAATGCAAGTGATCACTGAGCAGTGGCATGCCAATCACCGTACAATTTTCGGTGCCAAGTAGCCTTC
GTAATTTGTTTCAAATGTAAACATGACATGCACTGAGTGCTGAAATTTGTTTGTTTATGTGACGCAAAAT
page-top