Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig55
Contig Information
Length 673 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15g07    rwhec15g07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08901 [Oryza sativa Indica Group]
Score 91
Evalue 0.198124
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig55
AAATGTCTGGATGATCTTTGTTTTGTAGAATGTGTGCTGCTATAATTAGGCCATGTGAAATTATAGGTATACTTTCTTGAGCTGCTGCAGATCCTTTTAA
CAGCGAAGATATTTACGGCAGCCTACTCCATGTAGATTTTACAGCGAAAAACTGAAGAACTTGTGATGGCCACAAAGAGACTGAAATATTTGCACGAAGC
GAAGACATCCACCCGGATGACCCTTGTCCTGGACCCTCGGGCTGTGGTAAAAGAACCCTTTTGCTGGCATTTTCTCTCAAGGCACTATTGACCATTCTGG
GCTCCTCGCAAATATTGAAAGCAAAAGAAGAGTCACTAAGGGCCTGTTCGGCAGCTCCCCAACTCCCATAAATCCTGAAATCCAGCTTCTATTTTGGATC
GCCAGCTTCCGACGCGAGCGCTAGCGCTGAGAAATTCGTTCGGTGTCTCAGCTCCAGGTTTCGGTCGCCACACATGGGCTGCTAGCCATATTCACTGGAA
TTCGGCCTTGTTGGGTATTGAGAAGAGGCTGAAGTGAGCCCAAGAAGGACGCTGGGGGGAAAGTCACGTGATGCCTGGCTCCTAGGGGCTGGAAAGTTGG
CTAAAAGGCCTAATTTGGACCGAGTGGAGGGCATTTTTCAGCCCAGATCGCTGGGAGACAGCGTTTTCTCCCT
page-top