Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig53
Contig Information
Length 1086 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15f21    rwhec15f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to Zinc finger protein 469 [Rattus norvegicus]
Score 80
Evalue 8.69317
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig53
CCGCATCTGGTTTTGTTAGCACGTTCCTATTAGTTTTTAATCAGCGGGCTAGGAATGGTTTCCCCATCCAACTAAGCTATCATTATTTTTTTTTGGAAAA
GGAGGATGACCCCCGGCCTCTTCATATGGGAGATGCATGCGGCCATTTTATTAATAGTAGTGGCGAAACTATTACTTGATAATGCGCAGAGTAAAAAAAC
AATGATAGACATTTTGTTGTTCCCCATCTCAAATGCCGATTTTGTTTAATGATGCTGAGATGATTCAACTTTGGAGATTTTGACGCGGTTTCCATACTCA
ATGATTTTTCTGAATGGGTAGTAAATATTTTCTTGACCGGTGATATTTCTTGTTGTGCAGGTATCTAGAGTTACATTCCGGTGGCTGAGATGCATATAGT
TGTTGGCTGTAGTTCCTTCCATTTGCCCGCTCGACGCTGAGATTGACCTTCTATGTAGCATGCAACACTCAGCTGGGAAATGTACTTATAGGAACTAATC
ACTTACTTTGCTGAACTCAGTATGCTGTCCAGTTTCCGCAGACATTTGTCAACTGGCAAGAAGGTTGAAGGCACATCGACTTGCTTCGATTAATTGCTGA
CAATTCAACCAGAGGGAGCAGCAAGCGACGGAGGCTCCTACACCCCAGGGGCTCGCCTGGGTGGCCCATGCCAGGGAAGAAAATGACAGGGAAGCAACGG
TGGCTGCTGGACGCATGTCATGCTGGCTCTTGAGAGTTGGATCTTTCGCGGCCTTGACTGGATGGCGGAAGATACGCCTCCCAGACGGCTGAGCAACTTC
AGATCCGGCTGGAAAGGGGGAAGGTTCACATGGCGTGATGTGAAGATGTAGGTTACCCAAGATGAACCTGAATTTCTTGCTCCTGCTCAAAGGAATAGGA
ACGTTTCCCGCAAAAAAAAGGAATAGGACTGTACTCCTCCCAAAAGACAAAAGCAAGAACCTTTTTCACCGCTGACTATACTCTCTCAAGTTCTGGTAAC
GGCGGGAGGGAGGCAGAGCAGAGACAAACGGCGCATTCCGTCATGCATGTGTGTGGATTTGTATCATCCTACTACTGTGTTTCTTG
page-top