Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig50
Contig Information
Length 876 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15f14    rwhec15f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13062 [Oryza sativa Indica Group]
Score 367
Evalue 3.21732e-33
Total Hit Count 64
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig50
ATGTTGTAGTGACATGCTGTTGTTAGTCACTGGTTTCAGCATAATTTATCTGTCACATATTTATCATCTTGTTCTAGGTCGTTCTCTCAGATTTGTGTTG
CTTCTGTGATATGCTATCCAATGCCAAACTAATCCTATATAATTGAAATTTACCCATTTTCTCTAGTGAATCTTGTTGGCAACTGTAGTCTCTGTAGTTA
TAGTTTCCATCGATTAAAACATATTTACTTGATATTTATATTCCTGGTAGACTCACTTTTTGCCGTTTCCTAACAGGAAGATCTTCCCGCCCTGCTCCAC
GTGCTGCTCCAGTGAGAAACCCACCAGCGCCAGCCCGTCAAGCTCCTCCACCTGCTACTACCCAGAGCAGCGGTGGTGGTATCATGAGCGGAATTGGGTC
CACTATTGCTCAGGGCATGGCTTTTGGTACTGGCAGTGCTATGGCGCACAGGGCTGTTGATGCTGTGATGGGTCCCCGTACCATTCAGCATGAGACTGTT
GTCGGTGAGGCTGCTGCATCTATGACTCCAATGGACAACGCTGCTGATGACAAGTGTGGCAACCCTTCCAAGGCCTTCCAAGATTGCATCAACCACTACG
GCAGCGACATCAGCAAGTGCCAGTTCTACCTCGACATGCTGAACGAGTGCCGCCGTGGAGGAGCAGGAGCTGGTGCAACTCTTTAAGCTACTATCTTTGC
TTGATTGGGGCTTAATTGGTCGGAGCCTGTTTTCAGTCATGATGATGATGATATATATCTCCTAAATAATTCATTGGCAATATTATGAACCTATGCCACA
GCTTATGTCTATTACCTACCCTAGTTTGTGGTCTCTGTTGTCTTGGGAGTATTTCCTTGTATTGATGTGGATCTAC
page-top