Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig48
Contig Information
Length 392 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15d08    rwhec15d08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit epoxide hydrolase [Arthrobacter aurescens TC1] >gi|119951629|gb|ABM10539.1| epoxide hydrolase [Arthrobacter aurescens TC1]
Score 79
Evalue 2.04521
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig48
GCGGTTACTACAACAACAACAACAACGAAGAAGGGTACTACCAGCCGAGGAACTTCAACAACAACAGGGGCAGGGGCGGTCGGTCTGGCGGCGGCAACTC
TTACTACGGCAACCAGGGAGGCGGCGGCGCGCAGGGAGGCGGCCACGCGTACGCCGAGAGGGTTGAGGCAAACGCTTAGTTGTTGAATTGTTTTGCTTGG
GTGGAGGTCACGAGAGGGAGAGAGAAGAGTCTGGGAGCCATTTTGTTATTATAGAACTAACTTAGCCTGTTATTACGTCGCAATCCGTCACCCATCTGTG
AGTTGGTTTTGTTGGTCCAATCCGATGACTGCATATGGTTGGTCGATAAATGTGGAATCTTGGTCGAAAGTAGCTTCAGGTCAAAAAAAAAA
page-top