Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig42
Contig Information
Length 930 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14k15    rwhec14k15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0697700 [Oryza sativa (japonica cultivar-group)] >gi|41052953|dbj|BAD07863.1| unknown protein [Oryza sativa Japonica Group] >gi|113537353|dbj|BAF09736.1| Os02g0697700 [Oryza sativa (japonica cultivar-group)] >gi|125540776|gb|EAY87171.1| hypothetical protein OsI_08572 [Oryza sativa Indica Group] >gi|125583348|gb|EAZ24279.1| hypothetical protein OsJ_007762 [Oryza sativa (japonica cultivar-group)] >gi|215767691|dbj|BAG99919.1| unnamed protein product [Oryza sativa Japonica Group]
Score 139
Evalue 9.83431e-07
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig42
ATATATATAGAAACAATCCACACAAAAGGCTGTTGCTAGTTGCAACCGGAGATTCAACACGGCTGTATCCACAGCTCGTAGCGACGGCGGTGATGGAAGA
TACAGCAATGTACAGATACAGTGGAGACGGCATCCAGGCTCATTCAGCAGGGCGCTGGCTCTCAGGCACGTCGCACTCGTCAAGCAGCGCCAGGATGTTA
TGCTCAGGGGCGCTCACGGAGGGCAGTATGGCCTCGTGCCGAATTCGGCACGAGGGGAAGATGACGATGACGAGGGGGTGGAGGGTGAGGAGAAGGGGTC
GGCGCCGCAGCAGGTGGTCGACATCTCCGACGAGGACGACGGCGGCGGCGACGAAGAGGAGGGTGGTGACGATGACGACGACGACGACGACGACGATGAT
GACGAGGAGGACGACGACGAAGTCGACGAGGAGGAGGAGCCTGAGGAGGAGCTAGGAACTGAATATCTGGTGCAGCCGCTTGGCCGTGCTGAAGACGAAG
AGCATTCCAGTGACTTTGAGCCAGAAGAAAATGGTGATGGTGCTGAGGACGAGGAGATTGAGGATGATGATGCTGAGGATGGTGAGGATTCTGTCAAGGC
GCAATCCTCTTCGAAGAGGAAGAGGTCTGGCGCGGAGGATGAAGATGATGATGACGGTGATGATGATGGTGATGATGATGAGAAGCCTCCATCAAAGCGA
TAGTCAATTTGTTCTTGCTGATCTGGTATCTTTTCTGCTTGGGCCAAGAAGGAAAATAATCCTCACGGAGAGGGTTGTTGGTAAATGCTGTAGCTTTAGG
ACATCTGTGGTAGGTGTAGCAGCTCGAACTTGAGTCTACCCATGTTAGTTGTTAGTGCATACTGCTGATGTTGATTAACAGCCTCGGGGAACTTCTGTAT
GAGCATTAGATATGGGGCTTGTTATATGCT
page-top