Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig40
Contig Information
Length 714 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14p02    whec14p13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100191783 [Zea mays] >gi|194689816|gb|ACF78992.1| unknown [Zea mays] >gi|195648120|gb|ACG43528.1| carbohydrate transporter/ sugar porter/ transporter [Zea mays] >gi|219888375|gb|ACL54562.1| unknown [Zea mays]
Score 874
Evalue 3.57309e-92
Total Hit Count 258
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig40
CTATTGAAGTTTGCCGACCTGAACATGAACCTCTAGCACTATCACTTGTCAGCACGGCATGGGGAATAGGTCTCATCATTGGTCCTGCTCTTGGAGGCTA
CCTTGCACTGCCTGCAGAAAAATACCCAAATATATTTTCACCTGACTCATTATTTGGAAGGTTCCCCTACTTCTTACCATGCTTGTGCACATCAGTCTTT
GCTGCCATTGTTCTGATAAGCTGCATATGGATGCCGGAGACGTTACACAAGCATAAAGTCAGTGATGATGGAAATCAAAGTGTTGAAGCTTTGGAGGCCC
ATCTGATTGATCCAAAAGAGGAGGTTGGACAAAGTAATAGTTCGAATACCAAGAAGAGCTTATTCAAGAATTGGCCATTGATGTCATCTATAATTGTTTA
TTGCGTCTTCTCCTTCCACGATATGGCTTATACAGAGGTGTTCTCTCTATGGGCTGAAAGTGACAGGAAGTATGGTGGACTGAGTTTATCATCTGAAGAT
GTAGGTCAAACACTTGCAATTACAGGTGCCAGTCTTCTTGTGTATCAACTATTTATGTACCCATCCATCATTAAAGTTCTTGGACCGATCAAATCTTCTC
AGATCGCAGCTGTTCTGTGCATACCTATTCTCTTTGCCTACCCCTATATGGACATACCTCTCAGGACCTGGAATTATCAATCGTACTGAATATTGCATCA
NTCATAAAAAATAA
page-top