Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig37
Contig Information
Length 860 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14m14    rwhec14m14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0390900 [Oryza sativa (japonica cultivar-group)] >gi|55296563|dbj|BAD69005.1| putative DsPTP1 protein [Oryza sativa Japonica Group] >gi|113532643|dbj|BAF05026.1| Os01g0390900 [Oryza sativa (japonica cultivar-group)] >gi|215737373|dbj|BAG96302.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218188275|gb|EEC70702.1| hypothetical protein OsI_02068 [Oryza sativa Indica Group]
Score 785
Evalue 1.06777e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig37
GGGAAGAGCCCCTGACGATGTCGGTGCCGGAGGCGGGGCAATCGGCGGGGAGGGACGAGCAGGAGATGGACGATTACGAGCAGCACCAGACCAGAGTGCT
CATGGCGCTGATGCAGGGCTTGTGCGCCGCGAGGTACCGCAAGGCCGACAACACCCCCTGCCTCGTCGACCAGGGCCTCTACCTGGGTTCTGTTGGAGCA
GCACTGAATAACGAGGCTCTGAAGAGCTTGAACATCACCCACATCTTGGTTGTTGCCAGATCATTGAATCCCGCTTTTCCAGCAGAATTTACGTACAAGA
AGATCGAGGTACTTGACAGCCCAGACACTGATTTGGGAAAGCATTTCGGTGAATGCTTTACTTTCATAGATGAGGGTATCTGCACTGGTGGCAATGTGCT
GGTTCACTGCTTTGCAGGTCGGTCGCGGAGTGTCACAGTTATTCTTGCATATCTTATGAAGAAGCATCAGATGAGCCTGCAAAGTGCCATGTCACTAGTT
AGAAGCAAACGACCTCAAATAGCACCCAATGCGGGCTTTATATCCCAGCTGGTGAACTTTGAGAAGTCTCTGCAAGTGGAGCAGGGACAAAGAACGTTGC
AATCTAACTAACTACAGGGTAATTTTTAGCCCAAGGAATCAGCGCTACAAGAATGCAGATGATACAGCAGTCTCCCCTGTAATAAATGTTCCCTGTAATG
CAGATGATACCTTTGCCCTCTTCATTTAGGGCCTGTTTGAATCACGGGGAATTTTCCTGTTGACTGTGGTAAAAGATCTGTTCCATTTTGATGCTCAATG
ATCTTCAGCAGCAGCAGCAGCAGCCGCCTTCTGAAATGAAAGATGTATATGTATGATCTT
page-top