Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig36
Contig Information
Length 540 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14o01    rwhec14o01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein DORLON_01181 [Dorea longicatena DSM 13814] >gi|149753584|gb|EDM63515.1| hypothetical protein DORLON_01181 [Dorea longicatena DSM 13814]
Score 85
Evalue 0.564753
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig36
CATTTGAATGGAAGATACCGACTACTGATGGAAGAAATCTGGAACTGAGCACGGGCAATAGCTGACAGAACGTCACAGACCAGAGAATAGGGCGCCCATC
TCTTCACTTTCTTAAAGCAATGCGTAAGGCTTTCGGCTTTCACCTTTCTTTGTAAAACAAACCCAATATCTTGACTTCCCAATGTCGCCAATGTCGATAT
GCCGGGTACCATCTTGACTTTCCAATGTCGCAAGTCAATCAGAAAAGGAGAATCCGGGTACTGTCAACCAAGTTCAGATAACCAAATAAACCAGTATAGT
ATCTTTGGATCAATTGAGAAGCTTCAAGTCCGTTATTATCTCAATCCGTATATTTTGCTTTCTTTCGCGCGGGAAGCGCAAGCCCTTGCTTGTGGGTCCT
GATCGAGCAAGACTACGTCCTATCTATCTACACCTCTCCAAACACAATATCTTGAGTACCCGGAACCATGTTCAGTGCTGCAAAAGCGCAGCTGTAGCCC
CCTAGAATCTTCGGCTCCTCGTTTTTAAACAAAAAAAAAA
page-top