Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig32
Contig Information
Length 824 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14o20    rwhec14o20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)] (no hit)
Score 1086
Evalue 1.00424e-116
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig32
CGGGAGATACCTGGGGTGCTGAATGGCCAGGAGCTGCAGCTCCAGCTGCTGCCGTCGAAGCCCCGGCTGGTGCTGAGTGGACTGGTGCTCCAGGTTTGAA
TGAAGACTCTTATTTTGTAATTGCATAATTAAATTGGAACTTTATGAACAACCTCTAGTCTCAGTTTCAGCCCACATTTGAGATCAACCTGCCGTCCTAG
TTTATTCTAGTACAAATTTTATCTCTATGGTCTTTGCTTGATCTGGGGATAGTAAGTTTTCAAGTTTGTTCACATTTAATTCATACCCCATTTTTTATCC
CACCCTTTACCAGATGCCATTTGCTATTCTGTACTTTCTTTTCCTGTCTCTGCCTATCAGTTTGACTATTGTTTGAAGCCTGAAATGTTTAAATTGTACT
CAAATTACATTTCTGAATTTCAGCTCCTGCGGCCGATGGATGGGATGCCGTTGCAGCACCTGCCCCTACTGGCTGGGAACAGGGCAGTGCTCCGGCACCT
GCAGCAGCACCAGCTGCTACTCAGAACTGGGAGTGAAGGACTTGACCCAAGGTTTATGCTACTCGGCACTCTGGAGTGAAGGAGTTCGGCCGTGGTTTAT
TGGTGAAGGCTGTGTTATTTGCCCCGTCAGTACTCTGTTGGTAGACGCTGGTTAAGTAGATTTAATTTTTACAGTACTGAGTTATGTTAGATGGAAATCG
ATTTTTGTCTTCTTGGCTTTGCAGGGGTTGGGAGTTATCACCCCAGCCTTCTGTTGCCTCTCATCGAATAGCTTTATTTGAAGTTCCATTTTGCCAGCAA
GTGTATGGTCAGATTCTCTGAAAT
page-top