Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig29
Contig Information
Length 1109 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14p04    rwhec14p04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_016624 [Oryza sativa (japonica cultivar-group)]
Score 987
Evalue 6.04911e-105
Total Hit Count 348
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig29
GCGTTGCGAGAACGACTAGCGCGGGCTATCCGGGTCCCAGTACTGCTACCAGCATGGAGGTCCCACGCTGCAGAAGTGTAGACCATTTCAAAACACCAGA
ACCTACCAAGGAAAGTAGTCTCCGGGACGAGGATGAGAGGCAGCCTAGTAGGAGAGGAAAGAAGCGAACTATCATGAACGACGGGCAGGTAAATGAAATT
GAGAATGCTCTGGTTGATGAGCCCGAGATGCATAAGAATGCCGCTTCCCTTCAGACATGGGCAGAGAAGCTGAGTGGGCAGGGTGCAGAGATCACATCAT
CGCAACTAAAGAATTGGCTGAACAACAGAAAAGCTAAGCTCGCTCGTATCGCGAAAGAAAGAGGAGTGCCATACGAGGGCGAGGGTGCTGACAAGTCATC
TACACCAGCTAATTCTCAGTTGGGTGACTCCTCAGAGAGTGCCGGCGAGGAGAGCTATCTGCCGCCTTCAAGGGTGCTGAATGCTCTAGGCTTATCCAAC
TCCAAGGGCAGCAGCAGGCTGGTTACCCCAGACTCCAGCGAGCCAAGTACACAAGACATGATGACGAGCCGGCCGTTCACAAGATCATTGTCATTCGAGC
CTGGCCGCCCCGTTCTGCTGATTGACAACGAAGGGAATGAAATCGGCAGGGGCGAGATCTTCCAGGTTGATGGCAGGGCCCAAGGGAAGAGCCTGGCGGA
GAGCCACACCTGCATCATCGACGTCACCGAGCTCAAGGTTGAGAAATGGAGGGAACTCCCCCACCCTTCCGAGGCGTCGGGAAGAACATTCCAGGAGGCG
GAGTCGAGGCATGGCGGCGTGATGAGGGTTGCCTGGGATGTTGTCAGGCTCGCTCCGGTGGCGACGTAGGGTGGTTGGTTCCCTTTTGTGGTGTCGGGAA
TGTAGCATCGAGAAGGTACAAACAGCAAGTAGAGAGAGAAGCTTCCTGTCAATCTAGGATCTGAAGCCAGGAATGAATCTTGGAGGGTGGCTCTTATTGT
AACTAGTGTTTGGTGAAGTCATCTGTCAAAGACTCTGTATCCTTATGTTGCATCCTCTTCTTAGGGTTTACTAATTCTGATATATCCGTCGCAACCGCTG
GTATGTGCC
page-top