Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig26
Contig Information
Length 172 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14p23    rwhec14p23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_73696 [Branchiostoma floridae] >gi|210121401|gb|EEA69113.1| hypothetical protein BRAFLDRAFT_73696 [Branchiostoma floridae]
Score 76
Evalue 4.59474
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig26
GATCCCCCAACACTCCCTGTGTGGTTTGTGTACTGCATACTAGTATCTGCTAGCAGTGTTGCCCCCTGGAGCCCATCATGTGCTTGTGGTGCCAATAAGG
ATGGGTTTTGTATCCTCTTGCCAGATCTGTACATAACTACATATACAATATTGTGGTAATTTAAAAAAAAAA
page-top