Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig25
Contig Information
Length 366 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15b16    rwhec15b16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein Sde_1965 [Saccharophagus degradans 2-40] >gi|89951210|gb|ABD81225.1| conserved hypothetical protein [Saccharophagus degradans 2-40]
Score 76
Evalue 4.56476
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig25
TTTGCTTCCTGCAACGAGAGCTCAGGTCTGTACAACGGTATGCTTCTGCTGGATGCAGCTACGCGTAGCTGCCAATGGCTAACATCACGTCCGGTTGATC
ATCATGTCCGAGTTGTGCAACGCTGCAGCTAAACGTGCTCGTCCCTGTCCCGCTATTTGATGTCAGAAAACAATAATAGTGATCGAACCTCAAAAGCTAG
AAGGCATCTAACAGAGAAGAGGGTTGTATGTTCTTATGTATGATTCTACAAATTGATTGTTGCGCGTGGGAGTAGAATATTGATAGAATGATAGTCATCA
TTGTCGTCCGCTTGCTCAAACTTAACAAGTAAAAGGTGAGCCCAGTTTTCTCCGTTAAAAAAAAAA
page-top