Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig24
Contig Information
Length 708 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15c04    rwhec15c04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit erythrocyte binding protein [Plasmodium vivax SaI-1] >gi|148800963|gb|EDL42368.1| erythrocyte binding protein [Plasmodium vivax]
Score 97
Evalue 0.044384
Total Hit Count 42
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig24
ACTTGATTAAGCAGCATGGCCCAACGGCATTTACAGAAGGTAGAAATTGTCATAAGGAGGGAGATAAGGCAGAAAGGGCTGACGGCCATATTTACAATGC
ATAGTACTTGATTTGTTCGATGACCTAAATAGAGGAATTGTCATGACAATGGCTCGACATAGTTATGCGAGTGTCAAAGCCTTGTCTTACAAAGTTGCAC
AAAATAAACCTGGTGCACGCCCAAAAGTGTGCAGAGTTGACGATCTTTAGACCCGATGGCCAGACCATTGCTGTGACGCAGCAGAGCTGAGAAGCTCTCT
TCAGCAAGCAGAACATAGAAGATACCATATCTAGCCTAGTCCATGGAAGAACTACTGGTTCGCTTTCTTTGGAGCGCCAGCTGGCTTGACAGCAGTGTTT
GTCCTCTTGACTTTAGTGTGGTCAGGAAGGTTGTTCTTTGGATCTTCGGTAGCTATAAGCTCAGTTTCTTGACCGACATTTGGCACAGATGTAGCTTCAA
CAACATTTCCAGCAGGAGCACCTTGTTCAGCCTGGCTAGCCACCTTGGCAGCAGAGGCAGAGAGTTCAGTGTCCTCGGGCTTTGAGGGCTCAGTAAAAAG
TTTGCGGCGAGCACTTTTTGGGCATGCTGATTTGCTGGGTGTTTTANGCATAATAGCCTGCCCTTTTCCTTTGAATGCANATATAGGAGTGTTCATCTCA
TCAANAGG
page-top