Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig23
Contig Information
Length 315 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14p21    rwhec14p21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_36525 [Oryza sativa Indica Group]
Score 123
Evalue 1.66264e-05
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig23
ATGATTGGAGTGGTGGAGAGATACAAAGAGCTTTCGAAGTTCAACCTAAGGCAGCTGACCTCACCACCGGAGAAGTAGTTTCTGCGTGAGAAATTCTTCC
TCCTGGTTGAGTTTTAATCATATGCGGTAACTAGCTACTGTGAAAGTCATTGCCAAATGATTCAGATGTATTATGTCGTTAAAAAGCATGGTCATTGACG
TGTGGATGCATCCTGGATTGCTTGCTTAATGCCGTATGGTGCAATTTTGGAACCTGTTGAATTTCCTACTACAGCAATCGTTGGAATAAAGGGTTAATTA
GATTCAAAAAAAAAA
page-top