Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig18
Contig Information
Length 686 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15b03    rwhec15b03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ethylene constitutive triple response protein [Triticum aestivum]
Score 474
Evalue 3.3841e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig18
TGAACCCTCCTATCGTACATTGGGATCTGAAGACACCAAACATGTTGGTGGACAAGAACTGGTCTGTAAAGGTAGGTGACTTTGGCTTGTCCAGATTTAA
GGCGACCACATTCATATCGTCGAAATCAGTCGCTGGAACACCACTAATGGATGGCGCCAGAGTTTCTCCGTGGCGAGCCATCCAACGAGAAATGTGACGT
GTACAGCTTCGGCGTGATCTTATGGGAGCTCCTGACTATGCAGCAACCATGGGGCGGCCTAGGCCCAGCACAAGTAGTAGGAGCAGTTGCATTCCAGAAC
AGAAGGCTCCCAATCCCCAAAGATACCATCCCAGAACTAGCTGCTCTTGTTGAATCATGTTGGGCTGATGATCCAAGGCAGCGCCCTTCGTTTTCAAGCA
TTGTGGATACGCTCAAGAAGTTGCTCAAGTCGATGCAGGGATCCGGTTCATGACAGTCCCGCGGATTCTTGCCCAACCATTCTTTTTTCTCTACTCTCTG
TCGATTAAAGCTAATCCACAACAAGGAATAAAGCAGTTAGTTGCCTTCAGGCACATGAGAGGGTAGCTGAAGCAGCAAAAGTGCAATGCTGCATCAGAGT
TTGTTGGCTCGTTCCCTGACCATTCATGTTGTCTCTGTATAGTGATTTGAGCTACAAATTTAAAGCTCTCGAGGGTCAGTGAGGTG
page-top