Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig17
Contig Information
Length 668 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15b10    rwhec15b10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit epoxide hydrolase, putative [Arabidopsis thaliana] >gi|3193297|gb|AAC19281.1| T14P8.15 [Arabidopsis thaliana] >gi|7268994|emb|CAB80727.1| AT4g02340 [Arabidopsis thaliana] >gi|20856515|gb|AAM26670.1| AT4g02340/T14P8_15 [Arabidopsis thaliana] >gi|23308303|gb|AAN18121.1| At4g02340/T14P8_15 [Arabidopsis thaliana]
Score 397
Evalue 1.30904e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig17
TTCGTGGTTGGACACGACTGGGGCGCACTCGTGGCATGGCAGCTCTGCCTGCTCCGGCCGGACCTTGTGCGGGCGCTCGTTAACCTCAGCGTGGCCTACC
ACCCGCGCAGCTCCGAGGGGAGCCCGCTCCAGGTCATCAGGGCCTTGTGCGGGGAAGACCACTACATGTGCCGTTTCCAGGAGCCTGGAGTCGCTGAAGC
CGAATTTGCTCTATACGACAATAGTCATAAGTTTAAGACGGTCTTTGGAATGCGCAAACCAGCTCCTCCTATTCTACCCAAGACAAATTTGAGAAGACAG
GGTTTACAGGAGGGCTTAACTACTACAGATGCATGGACTTGAATTGGGAGCTTTCTGCACCATGGACTGGAGCTCCAATAAAAGTAGCAACAAAATTCAT
CGTTGGGGACCTTGACGTTACATACAATGTACCGGGGGTGAAAGACTACATTCACAAGGGTGGCTTGAAAGCGAGCGTGCCGAATCTGGAGGATGTGGTT
GTCATGGAGGGAGTGAGTCACTTCTGCAACCAGGAGAAGCCTAATGAGGTTTCAGATTACATCTGCGAGTTCTTCAGCAAGTTCTGATTATATCAAGAGA
GTCTCGGCGAACCTACCTGTTTCGGTTCTGTTTATGTACTTATAAGTTGTTGATTACCACCATGCCAT
page-top