Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig16
Contig Information
Length 859 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15b09    rwhec15b09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 810
Evalue 1.33879e-84
Total Hit Count 206
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig16
CCGCCGCCGCCGCCGCCTGTCCTCGCCGAGGAGAAGGCGTCAGGTCGATCTCCGCGAGGACTTCCTCTCTCTTTCTCCCTTGCATCTGGACCAGCAGCTT
GAACTGGAGTGAGCTGATGGAAGCTGAAAGAAGCCAGCTTAGTCCAATCGACCCAAGAAGAGCTCGGTTTCCTTGTTGCATAGTGTGGACTCCCATACCC
TTCATCACATGGCTGATGCCATTTATCGGTCACATTGGCATTTGCAGAGAAGATGGTGTAATCTTGGACTTTGCCGGTCCAAATTTCGTGTCAGTTGACA
ACTTTGCCTTTGGAGCTGTTACACGCTACATCCAATTAAATGGTGATGAGTGCTATAAACTTCTTGACACCGGCGCAGAGACGACATGGGATGGTGCTCT
GAGGAAAGGCGTGCAGGAGTTTCAGAACAGGAACTACAACCTGTTCACCTGCAACTGCCACTCCTTCGTCGCCAACAACCTGAACCGGCTCTTCTACGCC
GGCCACGACAAGTGGAACGTGGTGAGCCTGGCCGCGGTGATGTTCCTTCGGGGCCGCTGGGTGAGCGCGGGAGCCGTGGTGAAGACCCTGGCGCCGTTCG
TTGTGGTGCTCGCCCTTGGCGTTCTCCTCGGCGGCACGACGTTCTTGCTCGGTCTCCTCGCCTTCGCAGCCGTCATGGCCGGGTGGTTCCTCGTGGGCAC
CTACTGCATCAAGGGCCTTGTGGAGCTGTAGCTGCAGCACACCGGGCTTGAGTTTGGATTGGGGACTTGGGGGGTCTCCTTGTGATTCCTTGTGCCTTAA
CCTTGTCTTTAACTTGTGCATCTTCTCATAACCCTTGTACATCTAACAGTAATCGTGCT
page-top