Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig15
Contig Information
Length 705 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15c09    rwhec15c09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_028727 [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 1.02712e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig15
GCCGGCGGCGAGGAAGGGAAGAAGAAAGCGTCGACCATGGTGGTCCGGATCCGGCTCGCGCGGTTCGGCTGCCGCAACCGGCCCTTCTACCGGGTGATGG
CCGCCGACAGCCGCTCCCCGCGCGACGGCAAGCACCTCGAGGTCCTCGGCTACTACAACCCGCTCCCCGGGAAGGATGGTGGCAAGAGGATGGGGCTCAA
GTTCGACCGGGTCAAGTACTGGCTATCTGTTGGGGCACAGCCATCAGATCCCGTGCAGCGTATCCTCTTCCGTGCCGGTGTTCTGCCGCCGCCTCCGTTG
CTAGCCATGGGCCGGAAGGGTGGACATCGTGACAGGAACCCCATTCATCCGATGACTGGCCGTCCCTTGGATCTTGAGGGTGTCACGATTGTCGATGATC
CCAATGCTGCTGAAGGTGATGCTGAAGCACCTACAGAACCTTCGTTGGAGGCGTGATAGATTTTCTGTTCTGGCATATGGAGTGGTGCTGCAAGGCAAAA
GAATTTGTTTGTTGTGCTTCTGTTAAGATCATGAGCACGTAGTGTATGATCTTCAACAATTTCGTCATGTAACTCTGCTTTGTTAGCCTTTGCTGCACCA
TGGGTTAGCCAGCCGTCTCCAGTCTACTACGCCGTGTCCTAATATGGTTCCTTTTGAATGGATTATGCAATTTCTGCATTCCTTTTGGATGCTCAAGTGA
CAAAT
page-top