Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig14
Contig Information
Length 638 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec17p06   
Homology (BLAST) Top Hit glucose and ribitol dehydrogenase homolog - barley
Score 355
Evalue 3.66355e-41
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig14
CTCGCACACCCACCAGAGCCCAGCCGTTTCTCCTCCTTCTTCACCGCCTCCGACCGAACCAGCTGCATCCACTCCGCACCGCCAGAGGGCTAGCTTCGTT
CGCTGCGTCGTCGCCAAGAGCACCGCCTACTCGCCGAGGGACCAGAGCGATGGCGTCGCAGCAGAAGTTCCCGCCGCAGCAGCAGGACTGCCAGCCCGGC
AAGGAGCACGCCATGGACCCCCGCCCCGAGACCCTCATCAAGAACTACAAGTCGGCCAACAAGCTCCAGGTAAAGCGGTTTTAACAGTTCTAGCACTGCT
TGTCGATGCCAGCTTCCATTAGGCTGCCGTTTAATACATGATTGTGTGCGCGTGCAGGGCAAGGTGGCGCTGGTGACCGGCGGCGACTCGGGCATCGGGC
GCGCGGTGTGCCTGTGCTTCGCGCTGGAGGGCGCGACGGTGAACTTCACGTACGTGAAGGGGCACGAGGACAAGGACGCGGAGGAGACCCTGCAGGCGCT
CCGCGACATCAAGTCCCGCACGGGCGCCGGCGAGCCCAAGGCGCTGGCGGGCGACCTCGGGTACGAGGAGAACTGCCGCAGGGTGGTGGAGGANGTGGNC
AACNCNCACNGNNNNNNCNTGNACNTCCTCNTNAANNA
page-top