Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig11
Contig Information
Length 741 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec9e21   
Homology (BLAST) Top Hit legumain [Hordeum vulgare subsp. vulgare]
Score 621
Evalue 8.49617e-63
Total Hit Count 120
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig11
AGCACATACATAGGCACATTCTTATATAGCCGGCCCCAAGGTTATTTTCAGGATACACTAACAGTACAATACAATACAATACTACATATTCACATTCGCG
TAAGCTGAGGACAAGGAACATACTAGTATGTACCTCAGCAGACTGATCGATCAAGCGCTGTACCCTTGGATCAAGGTGCTCAATCTTGCCGAGTTGTGAC
CGCCGCAGGTATTGATGCTTGCTTCCTTCATCGTCGTGCCAGAAACACCATTGTTGCATATATTTGCAAATGCTCGCATGTGCTTCATACCGTACTGAGT
GAGCGATCCACAATGAGACTCAAAGATCCGCACCATCCTCTTCAGGCAATCCCAGTCGTCCACTAGAGGCTTCCCAGAAGGTCTGACAGCTTGAAGCTCC
GAAGGTCCATTCTCGAAGCCAAATAGGAGCTTCCCAATAAAATCGATGCTGTTGTCAAGATGCTTCCTGTGGGCGACTGTCTCACTGATCTCCGTCAGAA
CGTTCGCCTTCTCTTTAGACTTTCCATGTAGCAGCTCATACTGAAACCAAACCAAGAACCTTCAGCTAACATAGGCCTAAGGCACAGACCAATACTAAAC
ACAAATACTAATCAGTCGCAGACACAGTGCTATAAGTTCCGATGCAAGAAACTCACTAGCAAGTACAACTAAAATGGAGAATTTCCTGTAAACAAGAAAT
AGCAACTGATATATCCAGTGTANACAACAAATCATCAATGG
page-top