Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig8
Contig Information
Length 718 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec8l03   
Homology (BLAST) Top Hit hypothetical protein OsJ_010322 [Oryza sativa (japonica cultivar-group)]
Score 395
Evalue 1.27171e-36
Total Hit Count 155
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig8
AATTCAGTAGCAATTCCACCTATCTTGACAAATCATACAATATAAAGTAAAAAAAAAAGATCCACAATATTGATTAACTGGGCCCACGTAGGNGGAAGAT
TACATTTTTCTGGGTACAAGTTGAAGAAAGCCGCACTTACTAGTTCAAAAATGAGGNGCATGCTGCACTATAAAACACTATACTAATCTTACCAGCAGAA
GAATACCCTTTAATACCGAATGTGGNGGATTTTCCGTAGATGATTGGTTTATGTATCAACTATGGTACAGGGATGCTTTTGCAGCTTGGTGGAGGCAGCC
ACACAAATGATTTTCTGTAGATGGTTGTTTTATTATGTATCAACTACGGTAAGAGATGCACAAGCTGCAGCCACACAAATGATACATAGCCATCTGAGCT
TCGGAGATGATCCTATGTGCATTGTACCAAACAAACAGGATCCACTTCCCTCAGCAGAGGCTCGGATAAAATTGGGAAGAACCCTTCAAGGATTCAACAT
CATCAATTGCAGTCCATGACTGCTCTTGCAGCTTGGCAGCCTCAGCAATATCCGAGTTGCAACCATACACATGTATTGCCAATCGTCTACGTGTTGGAGA
AGATGATCTTATGTAGGTATTGTACCAACTGATGACGTCCTCCTTCCCAACTGTCCTTAGCTCTTCAGCTTCCAGTTTTGACATATCAAACATATACCTT
TTGTCGGTAATCTGCGAC
page-top