Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig5
Contig Information
Length 712 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec8f22   
Homology (BLAST) Top Hit hypothetical protein OsJ_010406 [Oryza sativa (japonica cultivar-group)]
Score 366
Evalue 2.87747e-33
Total Hit Count 364
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig5
CTATGTATAAAACAGGGTGTGAAATCTAACTAGAACTTGAGGTGAACAAAAGACAAGTTTTGATGTAGATGCCAACAACGCTCTACCTAATCCATTAGAA
AGCTACAGATAACATGAACGATACATATCAAAGGATTGTCCCCCCTGCGTAACTGTGTCCTTCATGGCAAACAGTGAATAAGAAGGGATCTTCTCATGCA
GGATTGCTAGCCTTTCAGTCTTTTACCAAAAGGTCTGATTGCTCCGGGAGTTCACTGTCTTCGCCATTTCTGCCAAGTTCCTTCTGGCAGGGGACATTCA
TCGTTTGCTGCGAAGAGATAATTCCCGCAATGGCTTTCATGGCAGCAGCAGCCCGGTCACTGCTGACCACTTCCTCACCAGATCCCTCCACAGGTTCAGT
AATCTTACAAGGACCATCTTCATTCTGCTGTGGCGGAGGCACAAAAAAGGGTATCTTGCCCCTCTGCCAGTCATGAAGTACCATCTTGGCTGCTGTTGTC
AGATCAGGTTCCCCACCCTTGAGTAGCTTTCCACTCATCTTGCTCAGCTGGACGAGAAAATCATTATCATCAGCCCTGGTGAGAGCAAGATCAGTAAGTA
TAAAAGATGTGTCATCTCCTCCGGCTGTGGGTTTTAGTTATTATAGTGAAGGAACACCATCAGGTCAACAATGATGTGTGACGTTCATTATGGACCAGAG
TACTTAATAACC
page-top