Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig4
Contig Information
Length 726 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec4o11   
Homology (BLAST) Top Hit 14-3-3 protein [Triticum aestivum]
Score 296
Evalue 3.9445e-25
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig4
GATCAATCATCAACAAGCCATGAAAATTGCTAATACAGCAATACTAATAATGTGCTGCAATACAGGAAATAGTTTGAAATCTGCTAATGAACTAAGAAGC
GACGATGTCCACATGACCGTCCTCATGACTGTAGTCCACTAGGTACTTCAGCTCGACACGCTTCGCATAGCACCATCCTACCACATCTTATGATTCACAT
AGTGCAACCGACCCTAGTACATCTTATGATCCGAATGATACAGGTAGCTGCGTAAATGGACTCAGAAATAAACTTGGGCACGCTCGAGGGCCAATCAGTG
CCCCTCTCCCTCAGGCTTTGAGGCGGCTTCCTTGATCTCATCACCACCCTCCTCTGCGTTATCGGAGGTCCAGAGAGTCAAGTTGTCACGAAGAAGTTGC
ATGATCAAGGTGCTGTCCTTGTAGGATTCCTCGCCGAGGGAGTCCAGCTCAGCAATAGCTTCATCAAATGCCTACCAACAAGTAAACATTATTGACAGAT
GTAGACTGAGACCCTTTTTCCTCAATGTCAAGTAATGGTTCAAACTATACTTTCAATAGCATGAGTCGTTTCAACTGGTTGGCATAGTTAACAAGGATTG
TTGTTCATCATTCATAAAAAACTTTAAACTGATATAGTACCATAAAGTAAAGCATAAGAAATGCTGAAACAACAATTTCACCAGAGATCAGAATTGTACT
GTATATAGCTTCCATGACAAATGGGG
page-top