Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig3
Contig Information
Length 735 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec14b23   
Homology (BLAST) Top Hit hypothetical protein OsJ_002928 [Oryza sativa (japonica cultivar-group)]
Score 362
Evalue 9.00402e-33
Total Hit Count 132
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig3
AAAGCTTTCTGATCACATTACAACAAGTACAGTATTACAGATGAACTTGACATCGTAATTTGTTTTCTTGGGATAGTAATCGTTATTTGCTACTACATCT
CACTTCCCTCCAGAGTTGGGTTTCGCAAGCAGCTTCTTTGGTAGTTTATCCACTGGGGTTGTTTTCAGAAGGAACAGTCTGGCCGCGCGCTCTTTTAAAG
TGCCACCGCATTTTAGTCCATGAGTCTGGAGCTCCAGCTTTAGCTTCTCCATGCCAAGTGCCTCCAATTCTGCTGCTGAACTGAATGTTGCCAGGTCCAC
AGGCTCCTCTGAAAGAAGAGACTTGTTATTTACATCAGCAGATTCTTCCCCATTCTCAGAAGTTCCATTTTCAGAAGTGTTCTCAGGAGCATCTGATTTC
AGAACTTCTTCTGAAAGAGCACTCTTACCAATCTCAGAAGTTCCGTTTTCAGAAGTGTTCTCAGGAGCAGGCTGAACTGCCGTTCCCACCTCACACTCCA
AACTACCTTGTGACTCAAAATCACATCCTGATCTAATCTTTACTTCCATGGATTCCTGAAGAGCATTTCCATTTTCCTCTGAATCACTGCTCTGGGACTT
CTCACCTGAGGACTCTCCTTCTGAATGTGACCCAGAAACTGAAGCCAGATCAACCTTTTCCTCCTCACTTTTGTTGGATTCATTTGAGTAATTCCCATGA
TCAAGAGCTATGGGGTTTTGCATCTGCCCCCTCAT
page-top