Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2
Contig Information
Length 686 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec18j19   
Homology (BLAST) Top Hit hypothetical protein OsI_35514 [Oryza sativa Indica Group]
Score 341
Evalue 2.11777e-30
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2
CTACGCCGACGTATGTTCCCCTTCATTTCAGGGACCGAGCCGGAGTGGTTCTGAATATGAAGGACAAGTCTCTACCAATAGCATTTCAGCTTGTATCAGC
AACCAGTGTGCAACCAATGTAGAGCCACATCCACCTCGGGTCGACACGGCCGGCAGTACACTCTCACTGCTTAACAGCACAGATGGAGCCGCTCTTCTGC
TGGAGGAAGCCCCTAAGTCAACAATCGGCCCCCTTCCCTCCAGTGGCTATTGCGACACCCCCCAAGCTGGCAACCTAGATTGCAGGCACACCACCACCGG
AGAAAGGTCACCCAGTGAAGCCATGGAGCTAACAAGTCTAACGATGACATTGTTACAAAAAATCACAAATAATTTCTCCAAGGAGCGACTACTTGGTGAA
GGCGGATATGGAAAAGTTTATCTGATAAATGTAATGTACTTGATTGGCAAACACGTTACAAAATTATCAAAGGGACGTGTGAAGGTGTAAAATACCTTCA
TGAAGGATTGGAAAAACCATTTTACCATCTGGACCTAAAACTGGGCAATATACTTCTAGATGAAAACATGGCCCCAAAACTTGCCGATTTCGGTCTGTCC
AAGCTCTTCAACGAAGAACAAACCTGCAGGGTGACGCAAAATTTACGCGCAGGAACTATTGGATACATGCCACCGGAATACATAAA
page-top