Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1
Contig Information
Length 726 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec4i10   
Homology (BLAST) Top Hit Os08g0157600 [Oryza sativa (japonica cultivar-group)] >gi|113623001|dbj|BAF22946.1| Os08g0157600 [Oryza sativa (japonica cultivar-group)]
Score 645
Evalue 1.328e-65
Total Hit Count 45
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1
AGCATGCGTAGGTGCTTAATGCTTAATTGAGAGTCTAGAAGGGCTGCTCGGCAAGCATTAACATACAACACATAATAAATTGAGTTCTGTGAAACACTGC
ATTGCAAGGACTGAGAAGTCCTATAGTAGTAGCTTAGATGTAAATACTGCAATTTCTTGAAAATACACTACTCGTGAAGGCTGGTAATCATGTCGTAGCA
AGTAAATCACGTGGAGGGTTCGCTGTCAAGACGAATCCTCTTGGTACCAACCTCGTCAGAAGCCGGCACCCTATTCTCCTTTGCTTCCACCGAGCACCTC
TTGTAAGGTTTGAAGCCTGTCCGGCGGGATTTCATATTCAGGTGTGACAATTCAATGGGAAAGGTAGCAGCTCTTGGCCCAACCAATGTATCAAGTTCAT
GGTCCATAACTGCAGCACTCTTGTTGAGGTCGACCGTCACCGTAGTAGCTTCGTCTTGTTCCCCCCTGGGTACCACCTTCAATCCTTCTGCTTGTGGAGG
AGAAAAGCTTTGGGGAAGCTTTCCTCTACTGAACAGTTTATCGAAAGCCATACGACCCTCTTCGGAAACTTCCTTCCATGAATCATTTGTGCTTGAAATG
TTCCTAAACCTGCGGTGGTTCATGTCACCANCTGAANAATTACTGCAACATGCTTGCTGTGTCTTGTCNNTGGCTTGATCTTGGTTCTCANGAACATGTT
CTGCCTCTACATCACTACTTGATGGC
page-top