Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig2295
Contig Information
Length 812 bp
Tissue Dormant seed with water absorption
Clones 30 Clones [Download: CSV  ,  FASTA ]
whem1d16    whem2c14    whem2d01    whem2p09    whem3p17    whem4f14    whem5f14    whem7j11    whem7p20    whem8b13    whem11e24    whem12n03    whem13h10    whem14h05    rwhem1d16    rwhem1o05    rwhem2c14    rwhem2d01    rwhem2p09    rwhem3p17    rwhem4f14    rwhem5g23    rwhem7p20    rwhem8b13    rwhem11e24    rwhem12k09    rwhem12n03    rwhem13h10    rwhem14h05    rwhem15k21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit eukaryotic translation initiation factor 5A1 [Triticum aestivum] >gi|78191541|gb|ABB29983.1| translation initiation factor 5A [Dasypyrum breviaristatum] >gi|78191543|gb|ABB29984.1| translation initiation factor 5A [Secale cereale] >gi|78191547|gb|ABB29986.1| translation initiation factor 5A [Aegilops tauschii]
Score 845
Evalue 1.05465e-88
Total Hit Count 456
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig2295
TGGGCGGATGAGCAAACCGGAATCTAAGTTCCAGCCACCACTCAGTTCCAATTCCAAAGGGTATTATAATAGAGATAGATAGATAGATAACAAAGTACTA
GCAGCACCTCGAGCATTCGGTGTAAAAAACACACAAATCTGGATCAAACTTGTTTCACCCAACAGATATCTTGATGCCTATGTATGTGTATCTCAAACAC
CCAGAAGCACTAGATACCAAGTATCGCAGGTAGGCAACCACGCACAGCTGCTTACTTGCCACCACCGATTTCCTTCACAGCGCAGATCTGTTCTTCACCC
ATGGCGGACATCACAGACAGGATCAGGTCCTTGCCATCAGCAAATCCAGTCTTGATCTGGCCAAGCAGAACATCATCAGTGGGAAGCTTCAGGTCATCCT
TAGTGTTACCACTCTCAGTGAGAAGGCTGACATATCCATCATCAGTTATGTCAATCAGCTGATAATCTTGGCGGTCAACATGGGGGACGTCACAGTTGTG
GGATGAAGGAACGATATCCTCAAGCTTCTTTCCATTAAAGATGTCAATGGCAACAAAGTGACACTTTGCGTGACCATGCTTCCCAGTCTTGGAGGTGGAG
ACCTCAACAACCTTGCAGGGACGGGCCTTGATGACGATGTGTCCACCCTTGCGGATGGCGCCAGCCTGCTGCGGGTAGGTCTTGGAGGCGCCGGAGTCGG
CCTTGGACTCGAAGTGGTGCTCATCGGTGTCCGACATCTCCGACGATCCTCCTGAGTCCGGGGGCAAGTGGGGTGGTGGAGACGAGACGCAGCGGCAGCG
AGGGGCGGATGG
page-top