Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig2291
Contig Information
Length 1953 bp
Tissue Dormant seed with water absorption
Clones 27 Clones [Download: CSV  ,  FASTA ]
whem1f19    whem1m06    whem3d02    whem7a16    whem8n24    whem10d04    whem12d06    whem13c06    whem13g20    whem14n19    whem15e19    whem16o16    whem18l04    whem19d20    whem20h08    rwhem1f19    rwhem1m06    rwhem3d02    rwhem5n01    rwhem7a16    rwhem8n24    rwhem12d06    rwhem12i11    rwhem13g20    rwhem14n19    rwhem16o16    rwhem19d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock protein 90 [Triticum aestivum] >gi|110270510|gb|ABG57076.1| heat shock protein 90 [Triticum aestivum]
Score 2579
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig2291
TGTCCATGATTGGGCAGTTCGGTGTTGGGTTCTACTCCGCCTACCTCGTCGCCGAGAGGGTCGTCGTCACCACCAAGCACAACGACGACGAGCAGTACGT
GTGGGAGTCTCAGGCCGGTGGCTCCTTCACCGTCACTCGTGATACGTCTGGGGAGCAGCTCGGCAGGGGTACCAAGATGGTGCTCTACCTCAAGGACGAC
CAGATGGAATACCTTGAGGAGCGCCGCATCAAGGATCTAGTTAAGAAGCACTCTGAGTTTATCAGCTACCCCATCTCCCTGTGGACCGAGAAGACCACTG
AGAAGGAAATTTCTGACGATGAAGATGAGGAGGAGAAGAAGGATACTGAGGAGGGCAAGGTTGAGGATGTTGATGAGGAGAAGGAAGAGAAGGAAAAGAA
GAAAAAGAAGATCAAGGAAGTCTCTCATGAGTGGAACTTGGTCAACAAGCAGAAGCCTATCTGGATGAGGAAGCCAGAGGAGATCAACAAGGAAGAGTAT
GCTGCTTTCTACAAGAGCTTGACCAATGACTGGGAGGAGCATTTGGCTGTCAAGCACTTCTCTGTTGAGGGTCAGCTTGAGTTCAAGGCTGTCCTGTTTG
TGCCCAAGAGGGCCCCCTTCGACCTCTTCGACAACAAGAAGAAGGCCAACAACATCAAGCTGTACGTGCGCCGTGTCTTCATCATGGACAACTGTGAGGA
GTTGATCCCTGAGTACCTGAGCTTTGTCAAGGGTATTGTTGATTCAGAGGACCTTCCCCTGAACATCTCCCGTGAGACTCTCCAGCAGAACAAGATCCTC
AAGGTCATCAGGAAGAACCTTGTCAAGAAGTGCATTGAGCTCTTCTTTGAGATTGCTGAGAACAAGGAGGACTACAACAAGTTCTACGAGGCCTTCTCCA
AGAACCTCAAGCTTGGCATCCACGAGGACTCCCAGAACAGGACCAAGATTGCCGAGCTTCTGAGGTACCACTCCACCAAGAGTGGCGATGAGCTGACAAG
CCTGAAGGACTATGTGACCAGGATGAAGGAGGGACAGAACGAGATCTACTACATCACTGGTGAGAGCAAGAAGGCTGTGGAGAACTCTCCCTTCCTTGAG
AAGCTGAAGAAGAAGGGCTATGAGGTCATCTACATGGTTGACGCCATTGATGAGTATGCCATTGGTCAGCTCAAGGAGTTTGAGGGGAAGAAGCTTGTCT
CTGCCACCAAGGAGGGTCTGAAGCTTGATGAGAGCGAGGACGAGAAGAAGAAGCAGGAGGAGCTCAAGGAGAAGTTCGAGGGTCTGTGCAAGGTCATCAA
GGAGGTGCTGGGTGACAAGGTGGAGAAGGTCATCGTCTCTGACCGTGTTGTGGACTCTCCTTGCTGTCTGGTGACTGGTGAGTATGGGTGGACTGCCAAC
ATGGAGAGGATCATGAAGGCCCAGGCCTTGAGGGACTCGAGCATGGCTGGCTACATGTCGAGCAAGAAGACCATGGAGATCAACCCTGAGAACGCCATCA
TGGACGAGCTTCGCAAGCGCGCCGACGCCGACAAGAACGACAAGTCTGTCAAGGACCTTGTGATGCTGCTCTTCGAGACCTCCCTGCTCACCTCCGGCTT
CAGCCTGGAGGACCCCAACACCTTCGGCACCAGGATCCACCGCATGCTCAAGCTTGGCCTGAGCATTGACGAGGACGACGAGGCGCCTGAGAACGACACC
GACATGCCACCCCTGGAGGATGACGCTGGTGAGAGCAAGATGGAGGAGGTCGACTAAGCGCAAGGCCGTCGGCTGTCGTCGTTGGATGTCCATGCCCTGC
GTTGTTTTTATCTTTAGTGTCGAAGTTCGATGGTTTTGGCACGTTTAGCTGTATCGGTTTTGTCTTTTGGCTGGCCAAACATTAAGCGCGGTTAGCTGTT
TGTGGTACTCGTGGAACCAGTTCGTTATTGTTGGTTCTACAATAAAAAAAAAA
page-top