Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig2278
Contig Information
Length 1960 bp
Tissue Dormant seed with water absorption
Clones 19 Clones [Download: CSV  ,  FASTA ]
whem1g10    whem1g23    whem3c22    whem3l07    whem12f05    whem13g22    whem14e08    whem18j06    whem20m13    whem6j10    rwhem1g10    rwhem1g23    rwhem3l07    rwhem5e12    rwhem6j10    rwhem12f05    rwhem14e08    rwhem18j06    rwhem20m13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_28114 [Oryza sativa Indica Group]
Score 674
Evalue 2.53795e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig2278
TCCGCTCCCTACACTCCCTCCTTGCCTCTACGCCGCCAGCGGTCCATGGGCAAGTCAAGCAAGAAGTCCGCGGCCCCTACTGTCGTGGCGCCGGCGGCCG
TCCTTACCAAGGGGAAGGCCGGGAAGAAGCGCGAAGCCGATGACGAGATCAAGAAGGCTGTAAGCGCAAAGAAACAGAAGGCTGCGCCGGCAAAGGCGGT
GCCCGGGCCCAAAGAGGCCGCCAAGAAGGCCAAGAAGCAGCCGCCGCCCAAGAAGGTTGAGAGCAGCAGCTCTGAGGAGCAGTCATCCGAGTCCGAGGAG
GAGGAGGTTCCTAAGAAGACTGCAAAGCCTGTCAAACACGAGTCTTCAGATGATAGCAGCGACGATTCCTCCTTTGACGAGGAACCTGCAAAGAAGCCTT
CTGCTAAACCTGTGACCCCAGCTGCCAGCAACGGCTCGAAGAAAGGCAAGCCTGAGAGCAGCTCTTCCAGTTCTGAGGATGAGTCCGATGATGACGAGAA
ACCTGCTGCTCTGGTAAAGAGAACACCAGTCATCGAATCTGACAGCTCCGAGAGTGACTCAGATGATAGCTCAGATGAGGATGTTCCTGCCAAGACTCCT
GCTGCTGCTGCCAAGAAGGTAGATTCTTCAGACAGTTCTGAGTCGGAGAGTGAATCTGAGGATGAGGAGAAATCAAAGAAAGCCGCACAGGCCACCAAGA
TAGCTCCTGCAGCTGCTAAAAGAAAGGAGGAGCCCAGTGATTCCTCAGACAGTGATGAGAGTGATGAAGAGCCTCCCCAGAAAAAGCTGAAGGATGCTGC
GAAGGTTACTCCTAAGTCTGCCAAAAAGGACAGCACCAGTGATGATGACAGTTCTGATGAAAGCTCTGATGATGAGCCTAAAAAGAAAGTTACAACTGCC
ACAAAATCACAGAAGGAAGAGCCTAAAACTCCTGCTAGCAACAAAGGTCAGGCAACAGGGTCGAAGACCCTTTGGATGGGGAACCTTTCCTTCAATATTG
AGTATGATCAAGTGAAGCAATTTTTTGCACAAATTGGAGAGGTCGTTGATGTTCGCCTGGCTACCCATGAAGATGGCCATCCCAAGGGATTTGGTCATGT
TGAGTTTGCTACGGCTGAAGATGCTCAGAAAGCGCTTGATTCACTGAATGGTGGAGATCTAATGGGCCGTCCGGTGAGACTTGACATGGCTGCTGAAAGA
GGTGCAACTCCTCGCACCAGGGATGGTGGATCGTTTGGAAAACCAAGTGGAGGTCCCAGCCTCTCAGTATTTGTCAAGGGTTTTGATTCATCTCAACAGG
AGGATGCTATTCGGAGCTCTCTTCAAGAACACTTCTCTAAATGTGGAGAAATCACACGTGTCTCAGTTCCGATGGATTATGAGAATGGTGCAAGCAAAGG
GATAGCTTACATGGATTTTACTGATGAGAGTTCCTTTTCGAAAGCACTTGAGCTTAGTGGATCTGACCTAGGTGGCTGCAACTTGTATGTTGCCGAAGCT
AAGCCTAAGGGTCAATTTGGTGGCGTTGGTGGTCGATCTGGTGGCAGAGATGGTGGCCGCTCTGGTGGTGGCAGGTTTGGCCGGTCTGGTGGCCGTGATG
GCGGCGGCAGGTTTGGCCGGTCTGGTGGCCGTGATGGTGGCGGCAGGTTTGGCCGGTCTGGTGGCCGTGATGGCGGCAGAGGAGGCGGCCGAGGCTTTCA
GAGCAGACAGAGTGCTGGCACAGCTAGCGCAGGGAAGAAGACCACATTTGGTGACGATTAGAAACTTTTTGAGCCACAAAATGGTCTGATGCAACTGCCG
CGTGTCTAGACGACTGTATCCCCGTGTTTCCCATTATCCTAGTGGACCTAGTATCATTTGTCTGTAGTATTTTCTTGCCGCTATATGTTGTAATGCCAGA
ATTCTACTATATATGTTACACCTAGTGTTTTTATAATACTTCCTCTATCCAAAAAAAAAA
page-top