Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1044
Contig Information
Length 537 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 5 Clones [Download: CSV  ,  FASTA ]
whfl14i15    whfl15d19    whfl15a08    whfl10c10    whfl48e05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_017237 [Oryza sativa (japonica cultivar-group)]
Score 569
Evalue 4.17425e-57
Total Hit Count 264
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1044
caGATCTCGCCAAAACTCCACCGGAACGGGCGCGCTCCCGGCATTTTCTCCACAGCCCTCGTCGCGGACGAAGGCAGTAGATCCGGCGGACGGCGGCCCG
GCGCATCTCCTCGCCTGCGAAGGTGCATAGTTTGCTGGCTTGTGTTAGTTCGGGGGACCAGCAAAGTTACTGAAAATGGTGGTTCTTGCTGCTTCCATCA
TCTCAAAATCTGGAAAAGCACTTGTTTCGAGACAGTATGTTGACATGTCTCGAATTAGGATCGAAGGATTACTTGCAGCATTCCCAAAACTTGTTGGAAC
TGGGAAGCAGCACACTTATCTTGAGACTGAAAGTGTCCGTTATGTTTATCAACCTATTGAAGGCCTATATCTGCTGCTTATTACAAACAAGCAGAGTAAC
ATTCTTGAAGATCTGGACACACTGAGGCTACTATCCAAGCTTGTGCCTGAGTACTCTTCTCTGGATGAGGATAGTATCTGTAAAACAgcatttgAGCTTA
TATTTGCATTtgatgaggcaatctctctcgggaacaa
page-top