Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig2218
Contig Information
Length 907 bp
Tissue Dormant seed with water absorption
Clones 10 Clones [Download: CSV  ,  FASTA ]
whem5d14    whem8c22    whem12b17    whem14n08    whem16p22    rwhem5d14    rwhem8c22    rwhem12b17    rwhem14n08    rwhem16p22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=HMG1/2-like protein >gi|21803|emb|CAA77641.1| high mobility group protein [Triticum aestivum] >gi|114145392|dbj|BAF30985.1| high mobility globular protein [Triticum aestivum]
Score 359
Evalue 2.91446e-32
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig2218
TTTTTTTTTTAATCTAACATTACCCAGACTGATATTATCACAATGTTAGCCGGTGACAATGGACGGAAAGAGTAACCATCTAGGTACAAGCAGGGGCACC
CCGCGGAAGAGGACATACACCCTCCACCACTAGGGCATCCCCGCCGGCGGCGGCGCCAACAGGGAGCGCTATCCGTTATAGCAGGACAATGACAGGAAAA
AGGTAAAACAACATCACGATGTGAAGTGAAACTTGGGATAATTCTAGTGGAGATGGATAGGCTCCTTATGACACCACCGCACACAGCTCAGGTCCGTTCT
CGCACAGCAGCTCCCGACTTGTCCGCCGGAGCAGCCTTGACAAGATGCGTCTTCTTCACTCGTCATCGTCCTCGTCCTCATCGCTGCCCTCATCGTCATC
GTCGTCATTGATCTCCGACTTGGACTTGTCAGATTCCTCCTCATCTTCCTCCTCTACCTCCTTGGCCGCAGCCTTCTTTGGGGCAGCAGCAGCAGCGCTC
TCGCCCTTGTTGTAGGCAGCAATGGCCTTGTTGTACTCGCCCTTGAGCTTGTTGGCCTTGGCCACATAGGGGGCCTTTTCCGATTCGCTCAAGCTCTTCC
ACCTCTCACCGGCCGCTTTGCCGACGGCGGCGACGGACTTGTTCTTGGGGTTCTTCTGCTTGAACTCCTCGCGGAACTCGCCCATGAAGACGAAGAAGGC
GGATGGCGCCCTCTTGGGCTTGTTGGGGTCCTTGCCGGCCTTGCCCTTCTTCCCCTTGGCGGCCGGCTTCTCCGCCCCCTTGCTCTTCACCGCCAACTTG
GCGTCGGCCTTGGCGGCGCCCTTGGATTTGGCCCCCTTCATGGCTGGTTTCCTGGGGGGAGGGGGCGGGGGAGAGAGGGCGCTCCTGGTCTGGGTTGGGA
AAGGAGG
page-top