Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig2203
Contig Information
Length 1102 bp
Tissue Dormant seed with water absorption
Clones 10 Clones [Download: CSV  ,  FASTA ]
whem1a02    whem2e08    whem15k19    whem17l08    whem19o15    rwhem1a02    rwhem2e08    rwhem7h11    rwhem15k19    rwhem19o15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1091
Evalue 5.20684e-117
Total Hit Count 493
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig2203
TTTTTTTTAACAAAACAGAGGACAAGTTCTATTCAAACATAAAAACACAGGACAGGAATAAACTAAATATTTAGTTTTCAACTCATAACCTCCATCCAGA
AAGTAACACGAACAAAATAAGATAGCGGAACACTGGCTAGGAATGTCGACAGAAGTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACA
CCCAGGTGGCACATATATCATCTTCTAGATATGAAGCAGCAAAATAGCAACTTCTATCCTCTACTCAGCAGCAGCAACCTCCTCTGCTCCAGGAATCACC
TCATCTCCATCAGCAGGCCTGTCAAGCTTCACACCAACATCCTCCTTGTAGTCACCGTGAACCTCCATGAGCTTCCCCAGGTCGAACTTGGGGGCCTTCA
GGATCTTCACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCCTGAGGTGGCCTTCTCAATCTCCTTTCCAATCACCTCAGGGATGAACTTGTTCAC
AAGCTCCTTTAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACCATCTTGCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGC
TTCACCTGGTTTGGGCGTCTCTTGGTGAAGCCAATGGCGAACATGCGGAGCATGTAGTTGTCAGTGGTCTTCACATCCACATGAGCCTCAATGAGTGTCT
GCCACTTCCTCACAAGAGACCTGAGCTTGTCAGTGGTGAAGTCCATGCCCCAGAAGTTTGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCT
GATCTTCCTGTAGGCCTGGTCCTCATCGTTCTGAAGATCAGCTAGAGATACTTCGAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGC
GTCCTGGACACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCGGCGCCTTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCT
TCTTGCTTCCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGCCATGGTTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTGA
GC
page-top