Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig2200
Contig Information
Length 754 bp
Tissue Dormant seed with water absorption
Clones 10 Clones [Download: CSV  ,  FASTA ]
whem7h14    whem8o16    whem11b01    whem11p07    whem16m22    rwhem7h14    rwhem8o16    rwhem11b01    rwhem11p07    rwhem16m22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit translation initiation factor [Triticum aestivum]
Score 513
Evalue 2.87026e-50
Total Hit Count 304
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig2200
CAAAGAGGAGGAAGAACACCAAGGACTCACTACCAGCGCCTCTCCGCGATCCAAATCCTCCCGGGAAAGATCTTGGTTGATCTCTTCCTCCTCGACCGCC
TCCCAGGTTCTTGGTGCAGCTTTTGCCAGTCTCAGCAGGAGATTTCATGTCTGATCTTGACGTTCAGATCCCAACTGCCTTTGACCCCTTTGCCGAGGCG
AATGCTGGGGACGCTGGTGCAGCTGCCGGATCAAAAGACTACGTTCATGTACGCATCCAGCAGCGTAATGGTCGCAAGAGCCTGACCACTGTCCAGGGTC
TGAAGAAGGAGTTCAGCTACAGCAAGATCCTCAAAGACCTCAAGAAAGAGTTTTGCTGCAATGGTACAGTTGTCCAGGACACAGAACTTGGACAGGTCAT
TCAACTCCAGGGTGATCAGAGGAAGAACGTCTCAAACTTCCTTGTCCAGGCCGGCATTGTGAAGAAGGAACACATCAAGATTCATGGTTTCTGAGCAACT
GCCAGCTCCATATCAGAGTCTACATGCAAAGCAGCTATATATTGGTGGTGCAGTATATTTAGTTGTGTGCTAGCGCTAGCAGGCGTTACCAGCTTGCGCG
CTCTGAGTATACAGAAAATCTAGCATAGCCCACCTCTCTGCGTGTATGCTTGTTACCGTTGTGTTGAAACTTTGTAAGGAGCACCATCTTTAGATGGCTT
GTTACCCTCTCCCATCAAGGTTGGATAATAATATATGCTTTCTGAAAAAAAAAA
page-top